PPt4Web Хостинг презентаций

Главная / Биология / Что такое биоинформатика?
X Код для использования на сайте:

Скопируйте этот код и вставьте его на свой сайт

X

Чтобы скачать данную презентацию, порекомендуйте, пожалуйста, её своим друзьям в любой соц. сети.

После чего скачивание начнётся автоматически!

Кнопки:

Презентация на тему: Что такое биоинформатика?


Скачать эту презентацию

Презентация на тему: Что такое биоинформатика?


Скачать эту презентацию



№ слайда 1 Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ
Описание слайда:

Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ

№ слайда 2 Что такое биоинформатика? Исследование информационных процессов в биологических
Описание слайда:

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п. ?

№ слайда 3 Биоинформатика Исследование информационных процессов в биологических системах (к
Описание слайда:

Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.

№ слайда 4 Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема б
Описание слайда:

Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. Изучение структуры активного центра белка Разработка программного обеспечения для управления и быстрого доступа к биологическим данным Создание банка данных аминокислотных последовательностей

№ слайда 5 Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Применение
Описание слайда:

Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Применение компьютерных методов для решения биологических задач Применение компьютерных методов для решения задач молекулярной биологии ... и еще ỳже... Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации

№ слайда 6 Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузился
Описание слайда:

Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузился смысл термина?

№ слайда 7 gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttagg
Описание слайда:

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa

№ слайда 8 В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод эксперим
Описание слайда:

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК Организм ДНК «в пробирке» Последовательность выделение секвенирование ...TGCCACAAATCAC...

№ слайда 9 Для хранения все возрастающей информации о последовательностях ДНК в 1982 году б
Описание слайда:

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb

№ слайда 10 Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 1962.
Описание слайда:

Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166. Анализ аминокислотных последовательностей глобинов нескольких позвоночных Гипотеза молекулярных часов

№ слайда 11 Пионеры биоинформатики Маргарет Дейхофф Однобуквенный код аминокислот A,C,D,E,F,
Описание слайда:

Пионеры биоинформатики Маргарет Дейхофф Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation) 1965 Атлас последовательностей белков и их структур (1965)

№ слайда 12 Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978
Описание слайда:

Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978 Первая версия атласа содержала описание 65 (!) последовательностей белков

№ слайда 13 Банки данных Архивные (примеры: PDB, GenBank) за содержание каждой записи отвеча
Описание слайда:

Банки данных Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами

№ слайда 14 Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательнос
Описание слайда:

Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательностях http://www.expasy.org/sprot/ Курируемая база данных “Золотой стандарт” аннотации

№ слайда 15 Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарском
Описание слайда:

Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)

№ слайда 16 Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 48.9
Описание слайда:

Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 48.9 (24 января 2006) содержит 206586 документов 1986 2006 2001

№ слайда 17 Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последоват
Описание слайда:

Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация TrEMBL (Translated EMBL) Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа

№ слайда 18 Тенденция объединения 2002
Описание слайда:

Тенденция объединения 2002

№ слайда 19 Банк данных UniProt UniProt (Universal Protein Resource) UniProt Knowlegebase –
Описание слайда:

Банк данных UniProt UniProt (Universal Protein Resource) UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef

№ слайда 20 ~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерна
Описание слайда:

~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерная аннотация UniRef (UniProt non-redundant Reference databases) UniParc (UniProt Archive) 200 000 последовательностей Экспертиза Базы данных научной литературы

№ слайда 21 Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 58
Описание слайда:

Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586 Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!

№ слайда 22 Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата со
Описание слайда:

Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата создания и модификации Аннотация последовательности Последовательность

№ слайда 23 Основные поля записи SwissProt ID AC DE OS OC И сама последовательность, конечно
Описание слайда:

Основные поля записи SwissProt ID AC DE OS OC И сама последовательность, конечно.

Скачать эту презентацию


Презентации по предмету
Презентации из категории
Лучшее на fresher.ru